• Sher Ali

      Articles written in Journal of Biosciences

    • Random amplification of polymorphic DNA with conserved sequences reveals genome-specific monomorphic amplicons: Implications in clad identification

      Asim Azfer Anu Bashamboo Nasser Ahmed Sher Ali

      More Details Abstract Fulltext PDF

      The enzymatic amplification of genomic DNA with an arbitrary primer generates informative band profile useful for genome analysis. We used a set of synthetic oligodeoxyribonucleotide primers OAT15.2 (GACA)3.75, OAT18. 2 (GACA)4.5, OAT24.2 (GACA)6, OAT36 (GACA)9, comprising 4–9 consecutive units of GACA repeat, O33.15 (CACCTCTCCACCTGCC) and 033.6 (CCTCCAGCCCTCCTCCAGCCCT) for RAPD reactions of genomic DNA from different sources. The GACA based oligos of 15 and 18 base residues generated discernible genome specific amplicons whereas primers larger than 18 bases revealed smeary signals. The other oligos O33.15 and O33.6 also generated genome specific amplicons with more bands compared with those obtained from OAT15.2 or OAT18.2. The presence of OAT15.1 (GATA)3.75 and OAT15.2 (GACA)3.75 sequences in different genomes were ascertained by independent dot-blot hybridization prior to using them for RAPD reactions. The RAPD amplicons generated by evolutionarily conserved primer(s) or sequences shared by many species may be useful for clad identification in controversial systematics, comparative genome analysis, and for establishing the phylogenetic status of an organism.

    • A bubaline-derived satellite DNA probe uncovers generic affinities of gaur with other bovids

      Pritha Ray Supriya Gangadharan Munmun Chattopadhyay Anu Bashamboo Sunita Bhatnagar Pradeep Kumar Malik Sher Ali

      More Details Abstract Fulltext PDF

      DNA typing using genome derived cloned probes may be conducted for ascertaining genetic affinities of closely related species. We analysed gaurBos gaurus, cattleBos indicus, buffaloBubalus bubalis, sheepOvis aries and goatCapra hircus DNA using buffalo derived cloned probe pDS5 carrying an array ofBamHI satellite fraction of 1378 base residues to uncover its genomic organization. Zoo-blot analysis showed that pDS5 does not cross hybridize with non-bovid animals and surprisingly with female gaur genomic DNA. The presence of pDS5 sequences in the gaur males suggests their possible location on the Y chromosome. Genotyping of pDS5 withBamHI enzyme detected mostly monomorphic bands in the bubaline samples and polymorphic ones in cattle and gaur giving rise to clad specific pattern. Similar typing withRsaI enzyme also revealed clad specific band pattern detecting more number of bands in buffalo and fewer in sheep, goat and gaur samples. Copy number variation was found to be prominent in cattle and gaur withRsaI typing. Our data based on matched band profiles (MBP) suggest that gaur is genetically closer to cattle than buffalo contradicting the age-old notion held by some that gaur is a wild buffalo. The pDS5 clone has a potential for estimating the generic and genetic relationship amongst closely related bovid species.

  • Journal of Biosciences | News

    • Editorial Note on Continuous Article Publication

      Posted on July 25, 2019

      Click here for Editorial Note on CAP Mode

© 2017-2019 Indian Academy of Sciences, Bengaluru.