• Volume 24, Issue 1

      March 1999,   pages  1-137

    • Why a good curve is not hard to find

      Aniruddha Das

      More Details Fulltext PDF
    • Genomic imprinting: mom and dad (epi)genetics

      Arun Kumar

      More Details Fulltext PDF
    • The history of the cellular slime moulds as a “model system≓ for developmental biology

      J T Bonner

      More Details Fulltext PDF
    • Invitro culturedSpodoptera frugiperda insect cells: Model for oxidative stress-induced apoptosis

      Seyed E Hasnain Tarvinder K Taneja Nand K Sah Manjari Mohan Niteen Pathak Sudhir Sahdev Mohammad Athar Satish M Totey Rasheedunnisa Begum

      More Details Abstract Fulltext PDF

      Cellular imbalance in the levels of antioxidants and reactive oxygen species (ROS) is directly associated with a number of pathological states and results in programmed cell death or apoptosis. We demonstrate the use ofin vitro culturedSpodoptera frugiperda (sf9) insect cells as a model to study oxidative stress induced programmed cell death. Apoptosis ofin vitro cultured sf9 cells was induced by the exogenous treatment of H2O2 to cells growing in culture. The AD50 (concentration of H2O2 inducing about 50% apoptotic response) varied with the duration of treatment, batch to batch variation of H2O2 and the physiological state of cells. At 24 h post-treatment with H2O2 AD50 was about 475 Μm. Apoptosis could also be induced byin situ generation of H2O2 by the inhibition of catalase activity upon hydroxylamine treatment. Hydroxylamine acted synergistically with H2O2 with an AD50 of 2.2 mM. DMSO, a free radical scavenger, inhibited H2O2-induced apoptosis thereby confirming the involvement of reactive oxygen species. Exposure of cells to UV radiation (312 nm) resulted in a dose-dependent induction of apoptosis. These results provide evidence on the novel use of insect cells as a model for oxidative stress-induced apoptosis.

    • Expression of enhancing factor/phospholipase A2 in ICRC mice

      C Deshpande V Patki M G Deo R Mulherkar

      More Details Abstract Fulltext PDF

      Enhancing factor (EF), a growth factor modulator, recently identified as the mouse secretory phospholipase A2 (PLA2), has been isolated in our laboratory from the intestines of mice. EF modulates the action of epidermal growth factor (EGF) by mediating an almost 2-fold increase in EGF binding in a radioreceptor assay. EF has been localized immunohistochemically to the Paneth cells of the intestine, adjacent to the proliferating stem cell population. Although very weak staining was observed in the intestines of ICRC mice (ICRC is an inbred strain of mouse developed at this Institute) as compared to Balb/c mice, the enhancing activity was not detected in the partially purified, acid soluble intestinal proteins of the ICRC strain. However, studies using polyclonal antibodies against purified EF demonstrated that EF from Balb/c and ICRC intestines are either immunologically identical or closely related to each other although, quantitatively, EF was very low in ICRC mice. RFLP studies indicated that ICRC mice carry a mutation in the coding region of the EF gene resulting in loss of the BamHI. restriction site. On sequencing, a T insertion was found at position 166 from the ATG site thereby causing a disruption in the ORF. This probably results in undetectable levels of enhancing activity. In this paper we report the molecular characterization of the ICRC mouse with respect to theenhancing factor gene

    • Cytosine methylation levels in the genome ofStellaria longipes

      Q Cai C C Chinnappa

      More Details Abstract Fulltext PDF

      Environment-induced alteration of DNA methylation levels was investigated inStellaria longipes (Caryophyllaceae). Total cytosine methylation levels were measured using HPLC in 6 genets representing two ecotypes (alpine and prairie) grown in short day photoperiod and cold temperature (SDC) and long day photoperiod and warm temperature (LDW) conditions. The levels of methylated cytosine were 16.54-22.20% among the three genets from the alpine and 12.62–24.70% in the three prairie genets when they were grown in SDC conditions. After the plants were moved to the LDW conditions, all of the three genets from the alpine showed decreasing levels of DNA methylation up to 6 days of growing in LDW. When the plants continued to grow in LDW for 10 days the average methylation level in the prairie genotypes showed no significant change. Cytosine methylation level was also detected inHpall andSau3AI restriction sites using the coupled restriction enzyme digestion and random amplification (CRED-RA) procedure, in which 15 random primers were used. Fifty per cent of the amplified bands with either or both of these two restriction sites were identified as being methylated in an alpine genotype (1C) and approximately 66% were found to be methylated in a prairie genotype (7C). It was observed that the change in growing conditions from SDC to LDW induced a decrease of methylation levels inHpall sites.

    • Random amplification of polymorphic DNA with conserved sequences reveals genome-specific monomorphic amplicons: Implications in clad identification

      Asim Azfer Anu Bashamboo Nasser Ahmed Sher Ali

      More Details Abstract Fulltext PDF

      The enzymatic amplification of genomic DNA with an arbitrary primer generates informative band profile useful for genome analysis. We used a set of synthetic oligodeoxyribonucleotide primers OAT15.2 (GACA)3.75, OAT18. 2 (GACA)4.5, OAT24.2 (GACA)6, OAT36 (GACA)9, comprising 4–9 consecutive units of GACA repeat, O33.15 (CACCTCTCCACCTGCC) and 033.6 (CCTCCAGCCCTCCTCCAGCCCT) for RAPD reactions of genomic DNA from different sources. The GACA based oligos of 15 and 18 base residues generated discernible genome specific amplicons whereas primers larger than 18 bases revealed smeary signals. The other oligos O33.15 and O33.6 also generated genome specific amplicons with more bands compared with those obtained from OAT15.2 or OAT18.2. The presence of OAT15.1 (GATA)3.75 and OAT15.2 (GACA)3.75 sequences in different genomes were ascertained by independent dot-blot hybridization prior to using them for RAPD reactions. The RAPD amplicons generated by evolutionarily conserved primer(s) or sequences shared by many species may be useful for clad identification in controversial systematics, comparative genome analysis, and for establishing the phylogenetic status of an organism.

    • Role of mediators in electron transport from glucose oxidase redox centre to electrode surface in a covalently coupled enzyme paste electrode

      D Savitri Chanchal K Mitra

      More Details Abstract Fulltext PDF

      We have studied the glucose oxidase immobilized carbon paste electrodes in the presence and absence of small mediator molecules. We have used p-benzoquinone and riboflavin as mediators in our studies. The effect of mediator molecules on the electron transfer between the enzyme redox centre and the electrode surface was explained from the cyclic voltammograms and rotating disk electrode data. In the absence of oxygen, we have noted that the mediators play a central role in the electron transfer. We have also proposed a possible mechanism for the electron transfer from enzyme active site to the electrode surface via mediators, based on our observations.

    • Effect of γ-radiation on the ratio of [18F]2-fluoro-2-deoxy-D-glucose to glucose utilization in human glioblastoma cellsin vitro

      F H A Schneeweiss R N Sharan H Hautzel H W Müller-GÄrtner

      More Details Abstract Fulltext PDF

      The glucose consumption in tumoursin vivo as reflected by uptake of [18F]2-fluoro-2-deoxy-D-glucose (18FDG) using positron emission tomography (PET) is currently under investigation as a measure of tumour response to radiotherapy. The calculation of cerebral metabolic rate of glucose from18FDG-PET data requires a proportionality factor referred to as the lumped constant. In the presentin vitro study, the utilizations of18FDG and glucose have been measured in a human glioblastoma cell line (86HG-39) as a function of γ-radiation dose with various post-irradiation times and of different fractionation modes. The ratio of utilization of18FDG to that of glucose (RF/G), assumed to correspond to the lumped constant, was observed to increase 12 and 24 h after single fraction γ-exposure by factors ranging from 1.2 to 1.5 compared with the non-irradiated controls. It decreased after multiple fraction γ-exposure (4 × 2 Gy) by a factor of 0.7 compared with the single fraction schedule (1 × 8 Gy). The results suggest that the affinities of glucose transporters or hexokiriase enzyme or both for18FDG and glucose could be influenced by γ-irradiation in this tumour cell linein vitro. Apparent changes of the glucose consumption determined with PET in human tumours following radiotherapy may, therefore, not be solely due to changes in cellular metabolism or cell number but may also be due to changes in RF/G.

    • Nutritional and hormonal effects on storage proteins in the silkworm,Bombyx mori L.

      S Janarthanan S Sankar M Krishnan S Ignacimuthu

      More Details Abstract Fulltext PDF

      Starvation of 48 h old fifth instar larvae depressed storage protein titres initially for 48 h but retained the levels comparable to control thereafter, possibly due to nutrients obtained during the 48 h feeding after fourth ecdysis. After an initial decline ligated larvae accumulated maximum storage proteins in haemolymph. This is because of inhibitory juvenile hormone titre at the basal level besides the appropriate release of 20-hydroxyecdysone from the ectopic source(s). Injection of methoprene (10 Μg/larva) repressed accumulation of storage proteins while 20-hydroxyecdysone (10 Μg/larva) increased the same. P-soyatose injection to starved and ligated larvae accelerated storage protein accumulation in haemolymph, signalling nutrient indispensability for initiation of storage protein synthesis at the appropriate time of last instar development inBombyx mori.

    • Platelet Ca2+ handling in essential hypertension: Role of a plasma ouabain-like factor

      Shalini Gulati Madhu Khullar Ramandeep Singh Savita Kumari N K Ganguly B K Sharma

      More Details Abstract Fulltext PDF

      A humoral ouabain-like plasma factor has been observed in patients with essential hypertension (EHT). In the present study, we hypothesized that this humoral factor might be responsible for the elevated cytosolic free calcium concentrations [Ca2+]i seen in these patients. Patients with mild to moderate EHT and their normotensive first degree blood relatives (NTBR) participated in the study. Platelet Na+, K+-ATPase activity was assayed in EHT patients and their NT first-degree relatives. To confirm the ouabain-like activity in plasma from EHT patients, control platelets were incubated with EHT and NTBR plasma and their Na+, K+-ATPase activity was measured. In addition, the effect of EHT plasma on platelet45Ca-uptake was studied. Thein vitro effects of ouabain (10 ΜM) on (i)45Ca-uptake and (ii) [Ca2+]i response in control platelets were also observed. A decreased Na+K+-ATPase activity (P< 0.05) was observed in platelet membranes from EHT patients. Incubation of control platelets with EHT plasma decreased their Na+, K+-ATPase activity (P< 0.01) and increased their45Ca-uptake (P< 0.05). C-18 Sep-Pak filtered hypertensive plasma extracts (containing the ouabain-like fraction) also decreased Na+, K+-ATPase activity (P< 001) in control platelet membranes.In vitro incubation of control platelets with ouabain increased45Ca-uptake (P< 005) and [Ca2+]i response (P< 0.05) in these platelets. Thus it appears that an ouabain-like factor in the EHT plasma may contribute to the elevated platelet [Ca2+]i observed in EHT patients.

    • Guanidine hydrochloride-induced reversible unfolding of sheep liver serine hydroxymethyltransferase

      B Venkatesha Jayant B Udgaonkar N Appaji Rao H S Savithri

      More Details Abstract Fulltext PDF

      Equilibrium unfolding studies of sheep liver tetrameric serine hydroxymethyltransferase (SHMT, EC 2.1.2.1) revealed that the enzyme assumed apparent random coil structure above 3 M guanidine hydrochloride (GdnHCl). In the presence of non-ionic detergent Brij-35 and polyethylene glycol, the 6 M GdnHCI unfolded enzyme could be completely (> 95%) refolded by a 40-fold dilution. The refolded enzyme was fully active and had kinetic constants similar to the native enzyme. The midpoint of inactivation (0.12 M GdnHCl) was well below the midpoint of unfolding (1.6±0.1 M GdnHCl) as monitored by far UV CD at 222 nm. In the presence of PLP, the midpoint of inactivation shifted to a higher concentration of GdnHCl (0.6 M) showing that PLP stabilizes the quaternary structure of the enzyme. However, 50% release of pyridoxal-5′-phosphate (PLP) from the active site occurred at a concentration (0.6 M) higher than the midpoint of inactivation suggesting that GdnHCl may also act as a competitive inhibitor of the enzyme at low concentrations which was confirmed by activity measurements. PLP was not required for the initiation of refolding and inactive tetramers were the end products of refolding which could be converted to active tetramers upon the addition of PLP. Size exclusion chromatography of the apoenzyme showed that the tetramer unfolds via the intermediate formation of dimers. Low concentrations (0.3–0.6 M) of GdnHCl stabilized at least one intermediate which was in slow equilibrium with the dimer. The binding of ANS was maximum at 0.4–0.6 M GdnHCl suggesting that the unfolding intermediate that accumulates at this concentration is less compact than the native enzyme.

    • Dye mediated photoinactivation of bacteriophages by nitrogen laser

      Ruchi Sachdeva N S Bhagwanani D S Chitnis

      More Details Abstract Fulltext PDF

      The nitrogen laser (λ = 337.1 nm) was documented to have photosensitized inactivation of bacteriophages P1 and phage A havingEscherichia coli andSalmonella typhi as their respective hosts. Methylene blue and crystal violet had a direct virucidal effect whereas toluidine blue revealed accentuated lethal effect on photosensitization with N2 laser for both of the bacteriophages taken in the study. The other dyes such as congo red, neutral red, auramin O and safranine showed differences in their virucidal activity among the two bacteriophages. However, malachite green did not show any change for the two viruses both by itself and on irradiation with the laser. A possibility of photosensitizing effect of N2 laser for the therapy of viral infections needs to be explored.

    • Insect growth regulating and antifeedant effects of neem extracts and azadirachtin on two aphid species of ornamental plants

      Opender Koul

      More Details Abstract Fulltext PDF

      Leaf disc choice test bioassay demonstrated that formulated neem seed extracts were highly deterrent and growth regulatory to rose aphid,Microsiphum rosae (L.) and Chrysanthemum aphid,Macrosiphoniella sanbornii (Gillete). Effective concentrations to produce 50% feeding deterrence was 0.80 and 0.84% respectively for 2nd instar nymphs irrespective of bioassay duration. The disruption of aphid feeding was related to the presence of azadirachtin concentration in the extract. The toxicity on contact from the leaf surface or via topical application due to azadirachtin was significantly different and topical treatment was at least 7 times more effective for both species. Thus growth regulatory effects of azadirachtin were influenced by the host plant and the stage of treatment. Field evaluation with formulated neem extracts revealed the effect to be more of growth regulatory nature thereby showing that azadirachtin is a physiological toxin for aphid species. Neem seed extracts reduced the population of aphid on respective host plants significantly, EC50 values being 0.88 and 0.96% forM. rosae andM. sanbornii respectively.

    • Embryonic ecdysteroids in a mole crab,Emerita asiatica (Milne-Edwards)

      T Subramoniam R Tirumalai V Gunamalai K H Hoffmann

      More Details Abstract Fulltext PDF

      Using radioimmunoassay (RIA) and high performance liquid chromatography (HPLC), the presence of a complex mixture of free and conjugated ecdysteroids is reported in the embryonated eggs of a mole crab,Emerita asiatica. From an initial low value of 6.5 ng/g egg wet weight in stage I, the total ecdysteroids increased in concentration to 15.2 ng/g egg wet weight in stage III. This was followed by a sharp fall in stage IV, but again increased to 15.0 ng/g egg wet weight in stage VI. After a further decline in stage VII, the total ecdysteroids registered the highest value of 36.2 ng/g egg wet weight in stage VIII. This value, however, declined to a low level in the prehatching stage (IX). The concentration of the free ecdysteroids always predominated over the conjugated ones. The HPLC analysis of free ecdysteroids demonstrated the presence of 20-hydroxyecdysone and ecdysone in the ratio of 2.5. Purified lipovitellin II also contained free and conjugated ecdysteroids. The functional significance of the embryonic ecdysteroids as well as their nature of synthesis and storage within the eggs is discussed in the light of the information available on insect embryogenesis.

    • Occurrence and morphometry of the hypopharyngeal glands inScaptotrigona postica Lat. (Hymenoptera, Apidae, Meliponinae)

      R A C Costa C Cruz-Landim

      More Details Abstract Fulltext PDF

      As compared toApis mellifera where only workers have hypopharyngeal glands, inScaptotrigona postica, these glands occur in workers, queens and males. They are composed of two long axial ducts with many unicellular secretory alveoli interconnected by secretory canaliculi. The axial ducts are longer in males than in workers, but the alveolar areas of queens and males are generally smaller. In workers the alveoli have their greatest size in the nurses or middle-aged individuals while in queens and males they are larger in newly emerged individuals. The results indicate that the glands in workers may produce food for the brood as inA. mellifera, since they are well developed in the nurse workers. However, the function of the glands in queens and males remains to be clarified since these individuals have no part in brood care.

    • Protein evolution: The deciphering of latent facets — correlation of synthesis profiles of ribosomally directed proteins and enzyme directed peptides

      S Ranganathan D Kundu N Tamilarasu

      More Details Abstract Fulltext PDF

      Key facets pertaining to the evolution of proteins have been probed, using as springboard, the relevant data bases constructed from (i) 60 ribosomally directed proteins, whose 3D structures are known and having 10,000 residues and (ii) from 73 enzyme directed peptides, comprising of 524 residues. The preference profiles, both in terms of the choice of neighbours and the placement of the peptide bonds, have been delineated with respect to each of the 20 coded amino acids. By and large, the preference profile from both the sets are similar, thus giving importance to the nature of the side chains of the coded amino acids. The predictive power of the preference profile has been tested with good results, thus demonstrating the evidence of common preference pathways for peptide formation during evolution. The ribosomally directed protein synthesis, controlled by the genome, proceeds by the addition of single residues at a time. On the other hand, the enzyme directed peptide synthesis largely operates in a more energy conscious block mode, where each constituent of a large enzyme ensemble is engaged in precisely assembling the modules and transfering them to the adjacent one, thus realizing a sequence specific peptide synthesis. Of significance is the fact that, in spite of such divergence in assembly, predictions for neighbour preferences in ribosomally directed protein synthesis work well when applied to enzyme directed peptide synthesis. The findings here are significant since they provide (i) a clear picture of directed peptide synthesis in the absence of direct genomic control, (ii) evidence for the preferred formation of peptide bonds using protein templates, (iii) they also provide evidence for the presence of protein like structures, with catalytic activity, prior to the freezing of the genetic code arising from dominance of the information system and (iv) a logical approach to the evolution of a hierarchical pattern.

    • Principles of biological pattern formation: swarming and aggregation viewed as selforganization phenomena

      Andreas Deutsch

      More Details Abstract Fulltext PDF

      Migration automaton models are introduced which offer the possibility to directly analyse essential selforganization properties of biological pattern formation at the cellular level. We present examples of migration automata as models of collective motion and cellular aggregation—patterns that are typical for example in the life cycle of Myxobacteria. Linear stability analysis of the corresponding automaton Boltzmann equation allows to distinguish orientation-dependent (collective motion) and density-dependent (aggregation) instabilities.

    • Reconstruction of phylogenetic relationships

      Chandrika B-Rao Kshitish C Majumdar

      More Details Abstract Fulltext PDF

      In this paper, we provide an introductory overview to the field of phylogenetic analysis, which has wide applications in modern biology.

  • Journal of Biosciences | News

    • Editorial Note on Continuous Article Publication

      Posted on July 25, 2019

      Click here for Editorial Note on CAP Mode

© 2017-2019 Indian Academy of Sciences, Bengaluru.