• Volume 22, Issue 2

      March 1997,   pages  117-271

    • Neurotoxicological effects of deltamethrin on the postnatal development of cerebellum of rat

      N Patro S K Mishra M Chattopadhyay I K Patro

      More Details Abstract Fulltext PDF

      Deitamethrin (DLT) has been accepted to be 10,000 times less toxic to man than to insects. While toxicity of DLT in adult animals has been studied using biochemical and electrophysiological tools, reports on its developmental neurotoxicity are rather scanty. Wistar rat pups were exposed to DLT (0·7 mg/kg body wt/day, i.p., dissolved in propylene glycol from postnatal day 9–13. Equal number of age matched pups were used as vehicle controls. The animals were weighed and perfused intracardially on postnatal days 12,15,21, and 30 and their brains dissected out. Cerebellum along with the brainstem was separated by a transverse section at the tectal level and processed for morphometric and toxicological studies. The micro-and inter-neurons in the cerebellum are known to differentiate and mature, both morphologically and biochemically, during the postnatal life of rats. Postnatal exposure to DLT has been observed to delay the cytogenesis and morphogenesis of these neurons. In addition to this, damage to the developing vasculature has also been recorded in the form of thrombus and haemorrhage. Focal degeneration and spongy appearance of the tissue in the vicinity of the damaged blood vessels have also been recorded. The study has opened up several questions on the safety of this substance to the pregnant mothers and infants in the habitats where this substance is in use for vector control.

    • Purification and partial characterization of a type V like collagen from the muscle of marine prawn,Penaeus indicus

      P Sivakumar L Suguna Gowri Chandrakasan

      More Details Abstract Fulltext PDF

      The muscle collagen of marine prawn,Penaeus indicus, was isolated by limited pepsin digestion. Based on selective salt precipitation, amino acid composition and gel electrophoretic pattern, the major collagen was found to be a homotrimer of á 1 chain, similar to type V collagen of vertebrates. Electron microscopy of reconstituted fibrils, made for the first time from a crustacean species, revealed a characteristic 64 nm periodicity. Biochemical studies indicate a less than normal amount of associated carbohydrates and an increased alanine content The major collagen had a denatu ration temperature of 37°C with an intrinsic viscosity of 11.3 dl/g. Spectral characteristics of the major collagen were studied. Results suggest the presence of genetically distinct collagen types and acid resistant cross links in crustacean muscle.

    • Nucleotide sequence of a cucumber chloroplast proline tRNA

      Shailaja Hande C Jayabaskaran

      More Details Abstract Fulltext PDF

      The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCA-DAGCGCAψUUGUUUUGGNψFACAAAAUmsu7GUCACGGGTψCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNAPro (UGG), the other two known plant organellar tRNAsPro.

    • Mechanism of initiation of yeast mitochondrial DNA replication: Role of RNA polymerase

      Suzanne D’souza K Pasupathy

      More Details Abstract Fulltext PDF

      Yeast mitochondrial RNA polymerase was purified and resolved into 2 distinct fractions. Peak A was found to be nonspecific and exhibited characteristics of the core polymerase, whereas peak B exhibited characteristics of the holoenzyme.In vitro replication assays were carried out, using the peak B enzyme, the clonedori sequences and other DNA templates. It was found thatori 2 was the most efficient template for RNA polymerase primed DNA synthesis, as compared to all the other templates studied.

    • Molecular characterization of a cDNA encoding caffeoyl-coenzyme A 3-O-methyltransferase ofStellaria longipes

      Xing-Hai Zhang C C Chinnappa

      More Details Abstract Fulltext PDF

      A cDNA clone encodingS-adenosyl-L-methionine:trans-caffeoyl-CoA 3-O-methyl-transferase (EC 2.1.1.104; CCoAOMT) fromStellana longipes Goldie (long-stalked chick-weed) was isolated and studied. Structural analysis of both the nucleotide sequence and the predicted amino acid sequence suggests that our cloned sequence encoded a CCoAOMT enzyme ofStellaria longipes, which shared overall structural similarity with other plant CCoAOMTs but exhibited certain distinct characteristics. Southern blot hybridization and cloning analyses indicating a small CCoAOMT gene family in theStellana longipes genome and the absence of introns in the coding region of the cDNA-corresponding gene. Sequence variations in the coding region were found among three genotypes from geographically isolated populations. Higher levels of CCoAOMT mRNA were detected in stems and leaves than in roots. The cDNA-encoded protein expressed inEschendia coli was shown to utilize caffeoyl-CoA, but not caffeic acid or 5-hydroxy ferulic acid, as its substrate.

    • Conformation of nifedipine in hydrated 1,2-di-myristoyl-sn-glycero-3-phosphorylcholine bilayer molecular dynamics simulation

      D Gupta V Kothekar

      More Details Abstract Fulltext PDF

      The conformation of nifedipine, a cardiac and smooth muscle calcium ion channel antagonist is studied in a hydrated bilayer of forty nine 1,2-di-myristoyl-sn-glycero-3-phosphorylcho-line (DMPC) molecules using molecular dynamics (MD) simulation technique. The simulation was carried out in conditions of constant number, volume and temperature (NVT) at 310 K, which is above the liquid crystalline (Lα) transition temperature of DMPC. The periodic boundary conditions were applied in three-dimensions. Thus the model represented an infinite bilayer. The important geometric parameters characteristic to DMPC and nifedipine molecules were calculated and compared with other theoretical and experimental results pertaining to nifedipine and other related dihydrophyridine (DHP) analogues. Our results suggest that conformational parameters required for antagonist activity are fairly conserved during the interaction of nifedipine with DMPC bilary and bilayer stabilizes the drug conformation in the bioactive form.

    • Development of wing morphology in the Indian pygmy batPipistrellus mimus

      S Suthakar Isaac G Marimuthu

      More Details Abstract Fulltext PDF

      The growth and development of the wing parameters of the Indian pygmy batPipistrellus mimus was studied under natural conditions. Newborn young were marked with nontoxic coloured paint and were later marked with split rings. The wingspan and wing area showed linear growth until the age of five weeks, after which the rate of growth decreased. The observations on flight showed that at the age of 19 days the young were able to flutter their wings, at the age of 22 days they flew for a short distance and at the age of 29 days they exhibited sustained flight. The development of wing loading and aspect ratio are also presented. The decrease in wing loading as the bat grows is discussed as an advantage to sustain flight. The aspect ratio showed a high degree of scatter at early stages of life which decreased at the later period of growth. In general the development of wing morphology ofP. mimus is similar to that of other vespertilionid bats.

    • Factors influencing seasonal and monthly changes in the group size of chital or axis deer in southern India

      T R Shankar Raman

      More Details Abstract Fulltext PDF

      Chital or axis deer (Axis axis) form fluid groups that change in size temporally and in relation to habitat. Predictions of hypotheses relating animal density, rainfall, habitat structure, and breeding seasonality, to changes in chital group size were assessed simultaneously using multiple regression models of monthly data collected over a 2 yr period in Guindy National Park, in southern India. Over 2,700 detections of chital groups were made during four seasons in three habitats (forest, scrubland and grassland). In scrubland and grassland, chital group size was positively related to animal density, which increased with rainfall. This suggests that in these habitats, chital density increases in relation to food availability, and group sizes increase due to higher encounter rate and fusion of groups. The density of chital in forest was inversely related to rainfall, but positively to the number of fruiting tree species and availability of fallen litter, their forage in this habitat. There was little change in mean group size in the forest, although chital density more than doubled during the dry season and summer. Dispersion of food items or the closed nature of the forest may preclude formation of larger groups. At low densities, group sizes in all three habitats were similar. Group sizes increased with chital density in scrubland and grassland, but more rapidly in the latter—leading to a positive relationship between openness and mean group size at higher densities. It is not clear, however, that this relationship is solely because of the influence of habitat structure. The rutting index (monthly percentage of adult males in hard antler) was positively related to mean group size in forest and scrubland, probably reflecting the increase in group size due to solitary males joining with females during the rut. The fission-fusion system of group formation in chital is thus interactively influenced by several factors. Aspects that need further study, such as interannual variability, are highlighted.

    • Biomass estimates of terrestrial arthropods based on body length

      S R Ganihar

      More Details Abstract Fulltext PDF

      The relationship between body length and biomass (dry weight) was investigated for nineteen taxa of terres trail arthropods and for the combined sample that included all insect taxa. The specimens were collected from forests of Bicholim taluk of Goa. Four models were evaluated, a linear function, a logarithmic function, a power function and an exponential function. The linear function best describes dry weights in the order Isopoda of class Crustacea and dictyopteran, coleopteran larvae of class Insecta. The logarithmic function fits well for only one group namely Opiliones of class Arachnida. The power functions fits best for Scutigeromorpha and Scolopendromorpha of class Chilopoda, Araneae of class Arachnida, Collembola, Thysanura, Orthoptera, Hemiptera, Homoptera, coleopteran adults, Diptera, lepidopteran adults and Hymenoptera of class Insecta and the combined data on adult insects. An exponential function fits well for the dermapteran and lepidopteran larvae of class Insecta. The usefulness of these estimates of Arthropod biomass in community ecology is discussed.

    • Radium-226 levels in the Cauvery river ecosystem, India

      P Shahul Hameed K Shaheed S S N Somasundaram M A Riyengar

      More Details Abstract Fulltext PDF

      We studied the natural radioactivity distribution of an α-emitting radionuclide,226Ra in water, sediment and biota (plankton, weed, snail, bivalve, prawn and fish) of Cauvery river ecosystem extending a stretch of 95 km. The dissolved226Ra concentration in river water ranged from 0.82mBq.I-1 to l 06mBq.l-1 (mean: 0.93mBq.l-1) and the activity in river sediments from 4.7Bq.kg-1 to 6.9Bq.Kg-1 (mean: 5.6Bq.kgg-1 dry wt.). The226Ra activity levels in the biota were within a narrow range from below detection limit to 3.80 Bq.kg-1 (wet wt). Generally higher226Ra concentrations are observed in the shells and bones of aquatic organisms than in their tissues and muscles. The concentration factors (CFs) of226Ra for the biotic components ranged from ∼101 to ∼103. The significance of226Ra activity in the abiotic and biotic components of Cauvery river are discussed.

    • Ultrastructure of cell types of the olfactory epithelium in a catfish,Heteropneustesfossilis (Bloch)

      N C Datta Shovan Bandopadhyay

      More Details Abstract Fulltext PDF

      Transmission electron microscopical study of olfactory epithelium of a mud-dwelling catfish,Heteropneustes fossilis (Bloch) shows receptor, supporting, goblet and basal cells. The receptor cells are of ciliated and microvillous type. Both ciliated and microvillous receptor cells are provided with olfactory knob. The dendrite of all the receptor cells bears many longitudinally arranged microtubules. Occurrence of the rod cell and its function is quite debatable. Specialized juctional complexes between the receptor and adjacent cells are clearly noted. The supporting cells are both ciliated and nonciliated. The ciliated supporting cells are responsible for water ventilation in the olfactory chamber as well as in the inter-lamellar spaces. This facilitates better perception of odours by the receptor cells. In addition to providing mechanical support to other cells, the nonciliated supporting cells also have a secretory function which is evident from the present study. The different stages of maturity of goblet cells are well documented. The presence of white cells in the olfactory epithelium is a very rare finding.

    • Lead inhibits type-I iodothyronine 5′-monodeiodinase in the Indian rock pigeonColumba livia: A possible involvement of essential thiol groups

      Shyam Sunder Chaurasia Sunanda Panda Anand Kar

      More Details Abstract Fulltext PDF

      A study has been made to reveal the mode of action of lead inhibiting type-I iodothyronine 5′-monodeiodinase (5′-D) activity in the Indian rock pigeon,Columba livia. Administration of lead acetate (6 mg/kg body weight/day) for 20 days decreased 5′-D activity and glutathione content in the liver and kidney homogenates. It also reduced the serum concentration of 3, 3′, 5-triiodothyronine (T3) with a marginal increase in serum thyroxine (T4). Hepatic and renal lipid peroxidative process increased significantly following lead treatment, whereas the levels of antioxidant enzymes such as superoxide dismutase (SOD) and catalase (CAT) were decreased. The possible involvement of lipid peroxidative process in the inhibition of 5′-D activity inColumba livia is suggested.

    • Effects of cAMP forskolin and cyanoketone on invitro oocyte maturation in the catfish,Clarias batrachus

      Shail K Chaube S Haider

      More Details Abstract Fulltext PDF

      This study investigated the interactive effects of cyanoketone (CK), an inhibitor of 3β-hydroxysteroid dehydrogenase on the effects of cAMP and forskolin (FK) on oocyte maturation inClarias batrachus using an in vitro incubation technique. When the oocytes were incubated in the presence of 1 Μg/ml 17α, 20β-dihydroxy-4-pregnen-3-one[l7α, 20Β-DP, the maturation-inducing steroid (MIS) of this species] for 6h, they matured [85.3 + 1.36% germinal vesicle breakdown (GVBD)] normally after additional incubation for 20–30 h in plain medium. On the other hand, exposure to 1.0 and 8 0 mM of cAMP after MIS stimulation caused significant inhibition of GVBD but lower concentrations (0.1 and 0.5 mM) of cAMP were noninhibitory. However, when the oocytes were preincubated for 1 h with 1 μg/mI CK, a significant inhibition in the percentage of GVBD was recorded including the lower concentrations of cAMP. FK, an activator of adenylate cyclase, could significantly induce GVBD at all of its concentrations (0.1, 0.5, 1.0 and 10.0 μM) in a dose- and time-dependent manner. However, when the oocytes were exposed to 1 μg/ml CK for 1 h, prior to FK stimulation, a complete inhibition of GVBD occurred but when CK treatment was given after the FK stimulation, only a partial inhibition of maturation was observed. Taken together, these data indirectly suggest that FK induces catfish oocyte maturation probably by stimulating follicular production of Δ4 steroid ( 17α,20 β-DP)through an adenylate cyclase-c AMP-mediated pathway, a mechanism identical to the gonadotropin-induced oocyte maturation.

    • Evaluation of the role of leukotrienes on ovum implantation in mice

      Pranab L Pakrasi

      More Details Abstract Fulltext PDF

      Prostaglandins are considered to be one of the important mediators of ovum implantation. Various lipoxygenase products also have been implicated along with PGs for this process. A specific rather than preferential inhibitor of 5-lipoxygenase is used to investigate the role of leukotrienes in the event of implantation and decidualization process in mice. AA861, a selective inhibitor of 5-lipoxygenase is used in different dose levels like 50,100 and 500 μg in (A) intact pregnant mice (on D1-D4 and D2-D4 and D4); (B) delayed mice on (D3-D8); (C) pseudopregnant traumatized mice (on D1-D4). All the experimental animals of group A were killed on D6. Estrogen injected delayed animals of group  were killed 48 h after the induction of implantation. Implantation sites were counted as blue spot and compared with those of control animals. Traumatized animals of group C were killed 24 h after the mechanical traumatization and uterine weights were compared with those of vehicle treated controls. Results show that AA861 could not inhibit ovum implantation in either intact or ovariectomized delayed animals. It also did not show any adverse effect on tubal transport or development of embryos. AA861 did not have any inhibitory role on decidualization of pseudopregnant uteri also.

      This experiment shows that a selective inhibitor of 5-lipoxygenase enzyme may not impair the implantation in mice indicating a doubt about the involvement of 5-lipoxygenase products in implantation.

  • Journal of Biosciences | News

© 2017-2019 Indian Academy of Sciences, Bengaluru.