• Random amplification of polymorphic DNA with conserved sequences reveals genome-specific monomorphic amplicons: Implications in clad identification

    • Fulltext

       

        Click here to view fulltext PDF


      Permanent link:
      https://www.ias.ac.in/article/fulltext/jbsc/024/01/0035-0041

    • Keywords

       

      Genome analysis; conserved sequences; RAPD; monomorphic amplicons; molecular systematics; clad identification

    • Abstract

       

      The enzymatic amplification of genomic DNA with an arbitrary primer generates informative band profile useful for genome analysis. We used a set of synthetic oligodeoxyribonucleotide primers OAT15.2 (GACA)3.75, OAT18. 2 (GACA)4.5, OAT24.2 (GACA)6, OAT36 (GACA)9, comprising 4–9 consecutive units of GACA repeat, O33.15 (CACCTCTCCACCTGCC) and 033.6 (CCTCCAGCCCTCCTCCAGCCCT) for RAPD reactions of genomic DNA from different sources. The GACA based oligos of 15 and 18 base residues generated discernible genome specific amplicons whereas primers larger than 18 bases revealed smeary signals. The other oligos O33.15 and O33.6 also generated genome specific amplicons with more bands compared with those obtained from OAT15.2 or OAT18.2. The presence of OAT15.1 (GATA)3.75 and OAT15.2 (GACA)3.75 sequences in different genomes were ascertained by independent dot-blot hybridization prior to using them for RAPD reactions. The RAPD amplicons generated by evolutionarily conserved primer(s) or sequences shared by many species may be useful for clad identification in controversial systematics, comparative genome analysis, and for establishing the phylogenetic status of an organism.

    • Author Affiliations

       

      Asim Azfer1 2 Anu Bashamboo1 Nasser Ahmed1 3 Sher Ali1

      1. Molecular Genetics Laboratory, National Institute of Immunology, Aruna Asaf Ali Marg, New Delhi - 110 067, India
      2. Department of Zoology, Aligarh Muslim University, Aligarh - 202 002, India
      3. College of Veterinary Science, Assam Agricultural University, Khanapara, Guwahati - 781 022, India
    • Dates

       
  • Journal of Biosciences | News

    • Editorial Note on Continuous Article Publication

      Posted on July 25, 2019

      Click here for Editorial Note on CAP Mode

© 2017-2019 Indian Academy of Sciences, Bengaluru.